Hi all,
maybe useful with Microsoft DNA ink or other cheap DNA kits,
so that you don't need a laboratory.
C:\Users\xxxxxxxx\Desktop>dnacrypt genkey 52 key.txt
Random DNA key of length 52 generated using TPM 2.0 and saved to 'key.txt'.
C:\Users\xxxxxxxx\Desktop>dnaentropy key.txt
Shannon entropy of the DNA key (52 bases): 1.9397
✔ The key has high entropy and appears well-distributed.
C:\Users\xxxxxxxx\Desktop>dnacrypt encrypt msg.txt key.txt out.txt
Plaintext as DNA (first 20 bases): TACATCTTTCGATCGATCGG...
Encryption complete. Ciphertext DNA saved to 'out.txt'.
Ciphertext: GGTAGGTTCAGCGAGGGCCGGTCATCATAGACCTGATGAGCTTCGCCT
https://github.com/Ch1ffr3punk/DNAcrypt
| Sysop: | Gate Keeper |
|---|---|
| Location: | Shelby, NC |
| Users: | 940 |
| Nodes: | 20 (0 / 20) |
| Uptime: | 497125:40:56 |
| Calls: | 15,886 |
| Calls today: | 11 |
| Files: | 5,345 |
| D/L today: |
4 files (8,192P bytes) |
| Messages: | 680,309 |